Isolation and genome characterization of Paenibacillus polymyxa 188, a potential biocontrol agent against fungi.

AIMS: In this work, we aimed to isolate marine bacteria that produce metabolites with antifungal properties. METHODS AND RESULTS: Paenibacillus polymyxa 188 was isolated from a marine sediment sample, and it showed excellent antifungal activity against many fungi pathogenic to plants (Fusarium tricinctum, Pestalotiopsis clavispora, Fusarium oxysporum, F. oxysporum f. sp. Cubense (Foc), Curvularia plantarum, and Talaromyces pinophilus) and to humans (Aspergillus terreus, Penicillium oxalicum, and Microsphaeropsis arundinis). The antifungal compounds produced by P. polymyxa 188 were extracted and analyzed using matrix-assisted laser desorption ionization time-of-flight mass spectrometry. The complete genome sequence and biosynthetic gene clusters of P. polymyxa 188 were characterized and compared with those of other strains. A total of 238 carbohydrate-active enzymes (CAZymes) were identified in P. polymyxa 188. Two antibiotic gene clusters, fusaricidin and tridecaptin, exist in P. polymyxa 188, which is different from other strains that typically have multiple antibiotic gene clusters. CONCLUSIONS: Paenibacilluspolymyxa 188 was identified with numerous biosynthetic gene clusters, and its antifungal ability against pathogenic fungi was verified.

Engineering the carbon and redox metabolism of Paenibacillus polymyxa for efficient isobutanol production.

Paenibacillus polymyxa is a non-pathogenic, Gram-positive bacterium endowed with a rich and versatile metabolism. However interesting, this bacterium has been seldom used for bioproduction thus far. In this study, we engineered P. polymyxa for isobutanol production, a relevant bulk chemical and next-generation biofuel. A CRISPR-Cas9-based genome editing tool facilitated the chromosomal integration of a synthetic operon to establish isobutanol production. The 2,3-butanediol biosynthesis pathway, leading to the main fermentation product of P. polymyxa, was eliminated. A mutant strain harbouring the synthetic isobutanol operon (kdcA from Lactococcus lactis, and the native ilvC, ilvD and adh genes) produced 1 g L-1 isobutanol under microaerobic conditions. Improving NADPH regeneration by overexpression of the malic enzyme subsequently increased the product titre by 50%. Network-wide proteomics provided insights into responses of P. polymyxa to isobutanol and revealed a significant metabolic shift caused by alcohol production. Glucose-6-phosphate 1-dehydrogenase, the key enzyme in the pentose phosphate pathway, was identified as a bottleneck that hindered efficient NADPH regeneration through this pathway. Furthermore, we conducted culture optimization towards cultivating P. polymyxa in a synthetic minimal medium. We identified biotin (B7), pantothenate (B5) and folate (B9) to be mutual essential vitamins for P. polymyxa. Our rational metabolic engineering of P. polymyxa for the production of a heterologous chemical sheds light on the metabolism of this bacterium towards further biotechnological exploitation.

Exploration of the Native Sucrose Operon Enables the Development of an Inducible T7 Expression System in Paenibacillus polymyxa.

The use of Paenibacillus polymyxa as an industrial producer is limited by the lack of suitable synthetic biology tools. In this study, we identified a native sucrose operon in P. polymyxa. Its structural and functional relationship analysis revealed the presence of multiple regulatory elements, including four ScrR-binding sites and a catabolite-responsive element (CRE). In P. polymyxa, we established a cascade T7 expression system involving an integrated T7 RNA polymerase (T7P) regulated by the sucrose operon and a T7 promoter. It enables controllable gene expression by sucrose and regulatory elements, and a 5-fold increase in expression efficiency compared with the original sucrose operon was achieved. Further deletion of SacB in P. polymyxa resulted in a 38.95% increase in the level of thermophilic lipase (TrLip) production using the cascade T7 induction system. The results highlight the effectiveness of sucrose regulation as a novel synthetic biology tool, which facilitates exploring gene circuits and enables their dynamic regulation.

Exopolysaccharides of Paenibacillus polymyxa: A review.

Paenibacillus polymyxa (P. polymyxa) is a member of the genus Paenibacillus, which is a rod-shaped, spore-forming gram-positive bacterium. P. polymyxa is a source of many metabolically active substances, including polypeptides, volatile organic compounds, phytohormone, hydrolytic enzymes, exopolysaccharide (EPS), etc. Due to the wide range of compounds that it produces, P. polymyxa has been extensively studied as a plant growth promoting bacterium which provides a direct benefit to plants through the improvement of N fixation from the atmosphere and enhancement of the solubilization of phosphorus and the uptake of iron in the soil, and phytohormones production. Among the metabolites from P. polymyxa, EPS exhibits many activities, for example, antioxidant, immunomodulating, anti-tumor and many others. EPS has various applications in food, agriculture, environmental protection. Particularly, in the field of sustainable agriculture, P. polymyxa EPS can be served as a biofilm to colonize microbes, and also can act as a nutrient sink on the roots of plants in the rhizosphere. Therefore, this paper would provide a comprehensive review of the advancements of diverse aspects of EPS from P. polymyxa, including the production, extraction, structure, biosynthesis, bioactivity and applications, etc. It would provide a direction for future research on P. polymyxa EPS.

Cloning, Expression, Purification, and Characterization of a Novel ß-Galactosidase/α-L-Arabinopyranosidase from Paenibacillus polymyxa KF-1.

Glycosidases are essential for the industrial production of functional oligosaccharides and many biotech applications. A novel ß-galactosidase/α-L-arabinopyranosidase (PpBGal42A) of the glycoside hydrolase family 42 (GH42) from Paenibacillus polymyxa KF-1 was identified and functionally characterized. Using pNPG as a substrate, the recombinant PpBGal42A (77.16 kD) was shown to have an optimal temperature and pH of 30 °C and 6.0. Using pNPαArap as a substrate, the optimal temperature and pH were 40 °C and 7.0. PpBGal42A has good temperature and pH stability. Furthermore, Na+, K+, Li+, and Ca2+ (5 mmol/L) enhanced the enzymatic activity, whereas Mn2+, Cu2+, Zn2+, and Hg2+ significantly reduced the enzymatic activity. PpBGal42A hydrolyzed pNP-ß-D-galactoside and pNP-α-L-arabinopyranoside. PpBGal42A liberated galactose from ß-1,3/4/6-galactobiose and galactan. PpBGal42A hydrolyzed arabinopyranose at C20 of ginsenoside Rb2, but could not cleave arabinofuranose at C20 of ginsenoside Rc. Meanwhile, the molecular docking results revealed that PpBGal42A efficiently recognized and catalyzed lactose. PpBGal42A hydrolyzes lactose to galactose and glucose. PpBGal42A exhibits significant degradative activity towards citrus pectin when combined with pectinase. Our findings suggest that PpBGal42A is a novel bifunctional enzyme that is active as a ß-galactosidase and α-L-arabinopyranosidase. This study expands on the diversity of bifunctional enzymes and provides a potentially effective tool for the food industry.

Development of a chemically defined medium for Paenibacillus polymyxa by parallel online monitoring of the respiration activity in microtiter plates.

BACKGROUND: One critical parameter in microbial cultivations is the composition of the cultivation medium. Nowadays, the application of chemically defined media increases, due to a more defined and reproducible fermentation performance than in complex media. In order, to improve cost-effectiveness of fermentation processes using chemically defined media, the media should not contain nutrients in large excess. Additionally, to obtain high product yields, the nutrient concentrations should not be limiting. Therefore, efficient medium optimization techniques are required which adapt medium compositions to the specific nutrient requirements of microorganisms. RESULTS: Since most Paenibacillus cultivation protocols so far described in literature are based on complex ingredients, in this study, a chemically defined medium for an industrially relevant Paenibacillus polymyxa strain was developed. A recently reported method, which combines a systematic experimental procedure in combination with online monitoring of the respiration activity, was applied and extended to identify growth limitations for Paenibacillus polymyxa. All cultivations were performed in microtiter plates. By systematically increasing the concentrations of different nutrient groups, nicotinic acid was identified as a growth-limiting component. Additionally, an insufficient buffer capacity was observed. After optimizing the growth in the chemically defined medium, the medium components were systematically reduced to contain only nutrients relevant for growth. Vitamins were reduced to nicotinic acid and biotin, and amino acids to methionine, histidine, proline, arginine, and glutamate. Nucleobases/-sides could be completely left out of the medium. Finally, the cultivation in the reduced medium was reproduced in a laboratory fermenter. CONCLUSION: In this study, a reliable and time-efficient high-throughput methodology was extended to investigate limitations in chemically defined media. The interpretation of online measured respiration activities agreed well with the growth performance of samples measured in parallel via offline analyses. Furthermore, the cultivation in microtiter plates was validated in a laboratory fermenter. The results underline the benefits of online monitoring of the respiration activity already in the early stages of process development, to avoid limitations of medium components, oxygen limitation and pH inhibition during the scale-up.

Genome-wide mapping of GlnR-binding sites reveals the global regulatory role of GlnR in controlling the metabolism of nitrogen and carbon in Paenibacillus polymyxa WLY78.

BACKGROUND: Paenibacillus polymyxa WLY78 is a Gram-positive, endospore-forming and N2-fixing bacterium. Our previous study has demonstrated that GlnR acts as both an activator and a repressor to regulate the transcription of the nif (nitrogen fixation) operon (nifBHDKENXhesAnifV) according to nitrogen availability, which is achieved by binding to the two GlnR-binding sites located in the nif promoter region. However, further study on the GlnR-mediated global regulation in this bacterium is still needed. RESULTS: In this study, global identification of the genes directly under GlnR control is determined by using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR) and electrophoretic mobility shift assays (EMSA). Our results reveal that GlnR directly regulates the transcription of 17 genes/operons, including a nif operon, 14 nitrogen metabolism genes/operons (glnRA, amtBglnK, glnA1, glnK1, glnQHMP, nasA, nasD1, nasD2EF, gcvH, ansZ, pucR, oppABC, appABCDF and dppABC) and 2 carbon metabolism genes (ldh3 and maeA1). Except for the glnRA and nif operon, the other 15 genes/operons are newly identified targets of GlnR. Furthermore, genome-wide transcription analyses reveal that GlnR not only directly regulates the expression of these 17 genes/operons, but also indirectly controls the expression of some other genes/operons involved in nitrogen fixation and the metabolisms of nitrogen and carbon. CONCLUSION: This study provides a GlnR-mediated regulation network of nitrogen fixation and the metabolisms of nitrogen and carbon.

Characterization of a novel GH26 ß-mannanase from Paenibacillus polymyxa and its application in the production of mannooligosaccharides.

A novel glycoside hydrolase family 26 ß-mannanase gene ppman26a was cloned from Paenibacillus polymyxa KF-1. The full-length enzyme PpMan26A and its truncated products CBM35pp (aa 35-328) and PpMan26A-Δ205 (aa 206-656) were overexpressed in Escherichia coli. PpMan26A hydrolyzed locust bean gum, guar gum, konjac gum and ivory nut mannan, with the highest specific activity toward konjac gum. The Km and kcat values for konjac gum were 2.13 mg/mL and 416.66 s-1, respectively. The oligosaccharides fraction obtained from the hydrolysis of konjac gum by PpMan26A was analyzed by matrix-assisted laser desorption ionization-time-of-flight mass spectrometer (MALDI-TOF-MS). The degradation products were mainly mannooligosaccharides with a degree of polymerization of 3-8. CBM35pp exerted strong binding activity toward mannans but without ß-mannanase activity. PpMan26A-Δ205, with the deletion of the N-terminal CBM domain, showed lower substrate binding capacity, resulting in reduced enzymatic activity and thermostability. This study complements our understanding of GH26 ß-mannanases and expands the potential industrial application of PpMan26A.

Multiple Receptors Contribute to the Attractive Response of Caenorhabditis elegans to Pathogenic Bacteria.

Nematodes feed mainly on bacteria and sense volatile signals through their chemosensory system to distinguish food from pathogens. Although nematodes recognizing bacteria by volatile metabolites are ubiquitous, little is known of the associated molecular mechanism. Here, we show that the antinematode bacterium Paenibacillus polymyxa KM2501-1 exhibits an attractive effect on Caenorhabditis elegans via volatile metabolites, of which furfural acetone (FAc) acts as a broad-spectrum nematode attractant. We show that the attractive response toward FAc requires both the G-protein-coupled receptors STR-2 in AWC neurons and SRA-13 in AWA and AWC neurons. In the downstream olfactory signaling cascades, both the transient receptor potential vanilloid channel and the cyclic nucleotide-gated channel are necessary for FAc sensation. These results indicate that multiple receptors and subsequent signaling cascades contribute to the attractive response of C. elegans to FAc, and FAc is the first reported ligand of SRA-13. Our current work discovers that P. polymyxa KM2501-1 exhibits an attractive effect on nematodes by secreting volatile metabolites, especially FAc and 2-heptanone, broadening our understanding of the interactions between bacterial pathogens and nematodes. IMPORTANCE Nematodes feed on nontoxic bacteria as a food resource and avoid toxic bacteria; they distinguish them through their volatile metabolites. However, the mechanism of how nematodes recognize bacteria by volatile metabolites is not fully understood. Here, the antinematode bacterium Paenibacillus polymyxa KM2501-1 is found to exhibit an attractive effect on Caenorhabditis elegans via volatile metabolites, including FAc. We further reveal that the attractive response of C. elegans toward FAc requires multiple G-protein-coupled receptors and downstream olfactory signaling cascades in AWA and AWC neurons. This study highlights the important role of volatile metabolites in the interaction between nematodes and bacteria and confirms that multiple G-protein-coupled receptors on different olfactory neurons of C. elegans can jointly sense bacterial volatile signals.

Investigation of bioactivity of unsaturated oligo­galacturonic acids produced from apple waste by Alcaligenes faecalis AGS3 and Paenibacillus polymyxa S4 Pectinases.

Pectin is one of the main structural components in fruits and an indigestible fiber made of D-galacturonic acid units with α (1-4) linkage. This study investigates the microbial degradation of pectin in apple waste and the production of bioactive compounds. Firstly, pectin-degrading bacteria were isolated and identified, then pectinolytic activity was assessed by DNS. The products were evaluated by TLC and LC-MS-ESI. The antioxidative effects were investigated using DPPH and anti-cancer effects and cytotoxicity were analyzed by MTT and flow cytometry. In this study two new bacterial isolates, Alcaligenes faecalis AGS3 and Paenibacillus polymyxa S4 with the pectinolytic enzyme were introduced. Structure analysis showed that the products of enzymatic degradation include unsaturated mono, di, tri, and penta galacturonic acids with 74% and 69% RSA at 40 mg/mL for A. faecalis and P. polymyxa S4, respectively. The results of anti-tumor properties on MCF-7 cells by MTT assay, for products of AGS3 and S4 at 40 mg/mL after 48 h, showed 7% and 9% survival, respectively. In the flow cytometric assessment, the compounds of AGS3 at 40 mg/mL were 100% lethal in 48 h and regarding S4 isolate caused 98% death. Cytotoxicity evaluation on L-929 cells showed no significant toxicity on living cells.

Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

Insights in the Complex DegU, DegS, and Spo0A Regulation System of Paenibacillus polymyxa by CRISPR-Cas9-Based Targeted Point Mutations.

Despite being unicellular organisms, bacteria undergo complex regulation mechanisms which coordinate different physiological traits. Among others, DegU, DegS, and Spo0A are the pleiotropic proteins which govern various cellular responses and behaviors. However, the functions and regulatory networks between these three proteins are rarely described in the highly interesting bacterium Paenibacillus polymyxa. In this study, we investigate the roles of DegU, DegS, and Spo0A by introduction of targeted point mutations facilitated by a CRISPR-Cas9-based system. In total, five different mutant strains were generated, the single mutants DegU Q218*, DegS L99F, and Spo0A A257V, the double mutant DegU Q218* DegS L99F, and the triple mutant DegU Q218* DegS L99F Spo0A A257V. Characterization of the wild-type and the engineered strains revealed differences in swarming behavior, conjugation efficiency, sporulation, and viscosity formation of the culture broth. In particular, the double mutant DegU Q218* DegS L99F showed a significant increase in conjugation efficiency as well as a stable exopolysaccharides formation. Furthermore, we highlight similarities and differences in the roles of DegU, DegS, and Spo0A between P. polymyxa and related species. Finally, this study provides novel insights into the complex regulatory system of P. polymyxa DSM 365. IMPORTANCE To date, only limited knowledge is available on how complex cellular behaviors are regulated in P. polymyxa. In this study, we investigate several regulatory proteins which play a role in governing different physiological traits. Precise targeted point mutations were introduced to their respective genes by employing a highly efficient CRISPR-Cas9-based system. Characterization of the strains revealed some similarities, but also differences, to the model bacterium Bacillus subtilis with regard to the regulation of cellular behaviors. Furthermore, we identified several strains which have superior performance over the wild-type. The applicability of the CRISPR-Cas9 system as a robust genome editing tool, in combination with the engineered strain with increased genetic accessibility, would boost further research in P. polymyxa and support its utilization for biotechnological applications. Overall, our study provides novel insights, which will be of importance in understanding how multiple cellular processes are regulated in Paenibacillus species.

Visualization and characterization of spore morphogenesis in Paenibacillus polymyxa ATCC39564.

Paenibacillus polymyxa is a spore-forming Gram-positive bacterial species. Both its sporulation process and the spore properties are poorly understood. Here, we investigated sporulation in P. polymyxa ATCC39564. When cultured at 37℃ for 24 h in sporulation medium, more than 80% of the total cells in the culture were spores. Time-lapse imaging revealed that cellular morphological changes during sporulation of P. polymyxa were highly similar to those of B. subtilis. We demonstrated that genetic deletion of spo0A, sigE, sigF, sigG, or sigK, which are highly conserved transcriptional regulators in spore forming bacteria, abolished spore formation. In P. polymyxa, spo0A was required for cell growth in sporulation medium, as well as for the initiation of sporulation. The sigE and sigF mutants formed abnormal multiple asymmetric septa during the early stage of sporulation. The sigG and sigK mutants formed forespores in the sporangium, but they did not become mature. Moreover, fluorescence reporter analysis confirmed compartment-specific gene expression of spoIID and spoVFA in the mother cell and spoIIQ and sspF in the forespore. Transmission electron microscopy imaging revealed that P. polymyxa produces multilayered endospores but lacking a balloon-shaped exosporium. Our results indicate that spore morphogenesis is conserved between P. polymyxa and B. subtilis. However, P. polymyxa genomes lack many homologues encoding spore-coat proteins that are found in B. subtills, suggesting that there are differences in the spore coat composition and surface structure between P. polymyxa and B. subtilis.

Fusaricidin Biosynthesis Is Controlled via a KinB-Spo0A-AbrB Signal Pathway in Paenibacillus polymyxa WLY78.

Fusaricidins produced by Paenibacillus polymyxa are important lipopeptide antibiotics against fungi. The fusGFEDCBA (fusaricidin biosynthesis) operon is responsible for synthesis of fusaricidins. However, the regulation mechanisms of fusaricidin biosynthesis remain to be fully clarified. In this study, we revealed that fusaricidin production is controlled by a complex regulatory network including KinB-Spo0A-AbrB. Evidence suggested that the regulator AbrB represses the transcription of the fus gene cluster by direct binding to the fus promoter, in which the sequences (5'-AATTTTAAAATAAATTTTGTGATTT-3') located from -136 to -112 bp relative to the transcription start site is required for this repression. Spo0A binds to the abrB promoter that contains the Spo0A-binding sequences (5'-TGTCGAA-3', 0A box) and in turn prevents the further transcription of abrB. The decreasing concentration of AbrB allows for the derepression of the fus promoter repressed by AbrB. The genome of P. polymyxa WLY78 contains two orthologs (named Kin1508 and Kin4833) of Bacillus subtilis KinB, but only Kin4833 activates sporulation and fusaricidin production, indicating that this kinase may be involved in phosphorylating Spo0A to initiate sporulation and regulate the abrB transcription. Our results reveal that Kin4833 (KinB), Spo0A, and AbrB are involved in regulation of fusaricidin production and a signaling mechanism that links fusaricidin production and sporulation.[Formula: see text] Copyright © 2021 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Production and сharacterization of the exopolysaccharide from strain Paenibacillus polymyxa 2020.

Paenibacillus spp. exopolysaccharides (EPSs) have become a growing interest recently as a source of biomaterials. In this study, we characterized Paenibacillus polymyxa 2020 strain, which produces a large quantity of EPS (up to 68 g/L),and was isolated from wasp honeycombs. Here we report its complete genome sequence and full methylome analysis detected by Pacific Biosciences SMRT sequencing. Moreover, bioinformatic analysis identified a putative levan synthetic operon. SacC and sacB genes have been cloned and their products identified as glycoside hydrolase and levansucrase respectively. The Fourier transform infrared (FT-IR) and nuclear magnetic resonance (NMR) spectra demonstrated that the EPS is a linear ß-(2→6)-linked fructan (levan). The structure and properties of levan polymer produced from sucrose and molasses were analyzed by FT-IR, NMR, scanning electron microscopy (SEM), high performance size exclusion chromatography (HPSEC), thermogravimetric analysis (TGA), cytotoxicity tests and showed low toxicity and high biocompatibility. Thus, P. polymyxa 2020 could be an exceptional cost-effective source for the industrial production of levan-type EPSs and to obtain functional biomaterials based on it for a broad range of applications, including bioengineering.

Effect of exopolysaccharides of Paenibacillus polymyxa rhizobacteria on physiological and morphological variables of wheat seedlings.

Paenibacillus polymyxa is a promising plant-growth-promoting rhizobacterium that associates with a wide range of host plants, including agronomically important ones. Inoculation of wheat seedlings with P. polymyxa strains CCM 1465 and 92 was found to increase the mitotic index of the root cells 1.2- and 1.6-fold, respectively. Treatment of seedlings with the exopolysaccharides (EPSs) of these strains increased the mitotic index 1.9-fold (P. polymyxa CCM 1465) and 2.8-fold (P. polymyxa 92). These increases indicate activation of cell division in the root meristems. Analysis of the morphometric variables of the seedlings showed that P. polymyxa CCM 1465, P. polymyxa 92, and their EPSs promoted wheat growth, increasing root and shoot length up to 22% and root and shoot dry weight up to 28%, as compared with the control. In addition, both strains were found to intensely colonize the seedling root surface. Thus, P. polymyxa EPSs are active metabolites that, along with whole cells, are responsible for the contact interactions of the bacteria with wheat roots and are implicated in the induction of plant responses to these interactions. The strains used in this work are of interest for further study to broaden the existing understanding of the mechanisms of plant-bacterial interactions and to develop effective biofertilizers for agricultural purposes.

Antigenotoxic potential of the fermentation broth produced by Paenibacillus polymyxa RNC-D in vitro.

Aim: Evaluate the chemopreventive potential of the extract from P. polymyxa RNC-D. Methods: Concentrations of P. polymyxa RNC-D extract were tested in HepG2/C3A cells to assess their genotoxic (comet assay), mutagenic (micronucleus test) and antigenotoxic potential (comet assay) in vitro. Results: 400 and 40 µg/ml concentrations induced DNA lesions, whereas the 4 µg/ml induced a desmutagenic effect. Complementary tests indicated that the extract minimized the formation of reactive oxygen species induced by methyl methanesulfonate and normalized the loss of membrane potential. The quantification of cytokines indicated that TNF-α was immunostimulated by the extract. However, when administered in conjunction with the methyl methanesulfonate, the extract blocked the TNF-α release. Conclusion: The fermentation broth from P. polymyxa RNC-D showed an antigenotoxic effect, and thus the potential to be used as chemopreventive compound.

Identification of Genes Involved in Fe-S Cluster Biosynthesis of Nitrogenase in Paenibacillus polymyxa WLY78.

NifS and NifU (encoded by nifS and nifU) are generally dedicated to biogenesis of the nitrogenase Fe-S cluster in diazotrophs. However, nifS and nifU are not found in N2-fixing Paenibacillus strains, and the mechanisms involved in Fe-S cluster biosynthesis of nitrogenase is not clear. Here, we found that the genome of Paenibacillus polymyxa WLY78 contains the complete sufCDSUB operon, a partial sufC2D2B2 operon, a nifS-like gene, two nifU-like genes (nfuA-like and yutI), and two iscS genes. Deletion and complementation studies showed that the sufC, sufD, and sufB genes of the sufCDSUB operon, and nifS-like and yutI genes were involved in the Fe-S cluster biosynthesis of nitrogenase. Heterologous complementation studies demonstrated that the nifS-like gene of P. polymyxa WLY78 is interchangeable with Klebsiella oxytoca nifS, but P. polymyxa WLY78 SufCDB cannot be functionally replaced by K. oxytoca NifU. In addition, K. oxytoca nifU and Escherichia coli nfuA are able to complement the P. polymyxa WLY78 yutI mutant. Our findings thus indicate that the NifS-like and SufCDB proteins are the specific sulfur donor and the molecular scaffold, respectively, for the Fe-S cluster formation of nitrogenase in P. polymyxa WLY78. YutI can be an Fe-S cluster carrier involved in nitrogenase maturation in P. polymyxa WLY78.

The Serine Biosynthesis of Paenibacillus polymyxa WLY78 Is Regulated by the T-Box Riboswitch.

Serine is important for nearly all microorganisms in protein and downstream amino acids synthesis, however, the effect of serine on growth and nitrogen fixation was not completely clear in many bacteria, besides, the regulatory mode of serine remains to be fully established. In this study, we demonstrated that L-serine is essential for growth and nitrogen fixation of Paenibacillus polymyxa WLY78, but high concentrations of L-serine inhibit growth, nitrogenase activity, and nifH expression. Then, we revealed that expression of the serA whose gene product catalyzes the first reaction in the serine biosynthetic pathway is regulated by the T-box riboswitch regulatory system. The 508 bp mRNA leader region upstream of the serA coding region contains a 280 bp T-box riboswitch. The secondary structure of the T-box riboswitch with several conserved features: three stem-loop structures, a 14-bp T-box sequence, and an intrinsic transcriptional terminator, is predicted. Mutation and the transcriptional leader-lacZ fusions experiments revealed that the specifier codon of serine is AGC (complementary to the anticodon sequence of tRNAser). qRT-PCR showed that transcription of serA is induced by serine starvation, whereas deletion of the specifier codon resulted in nearly no expression of serA. Deletion of the terminator sequence or mutation of the continuous seven T following the terminator led to constitutive expression of serA. The data indicated that the T-box riboswitch, a noncoding RNA segment in the leader region, regulates expression of serA by a transcription antitermination mechanism.

Genomics assisted functional characterization of Paenibacillus polymyxa HK4 as a biocontrol and plant growth promoting bacterium.

The diseases caused by phytopathogens account for huge economic losses in the agricultural sector. Paenibacillus polymyxa is one of the agriculturally important biocontrol agents and plant growth promoting bacterium. This study describes the antifungal potential of P. polymyxa HK4 against an array of fungal phytopathogens and its ability to stimulate seed germination of cumin and groundnut under in vitro conditions. The cumin and groundnut seeds bacterized with HK4 exhibited enhanced germination efficiency in comparison to controls. The use of HK4 as a soil inoculant significantly promoted the shoot length and fresh weight of groundnut plants in pot studies. The draft genome analysis of HK4 revealed the genetic attributes for motility, root colonization, antagonism, phosphate solubilization, siderophore production and production of volatile organic compounds. The bacterium HK4 harnessed several hydrolytic enzymes that may assist its competence in the rhizosphere. The PCR amplification and sequence analysis of the conserved region of the fusA gene amplicon revealed the ability of HK4 to produce fusaricidin. Furthermore, the LC-ESI-MS/MS of crude cell pellet extract of HK4 confirmed the presence of fusaricidin as a major antifungal metabolite. This study demonstrated the potential of HK4 as a biocontrol agent and a plant growth promoter.